if you want to remove an article from website contact us from top.

    a hypothetical ncrna is shown below. this ncrna is known to exert its function by binding to a protein and altering its structure. the underlined segment is the only part of the ncrna that physically contacts the protein. a mutation that disrupts the function of this ncrna is identified. surprisingly, the underlined sequence is normal in the mutant, but the boxed sequence in the dna, taa is changed to act. what is the most likely reason the ncrna no longer functions?

    James

    Guys, does anyone know the answer?

    get a hypothetical ncrna is shown below. this ncrna is known to exert its function by binding to a protein and altering its structure. the underlined segment is the only part of the ncrna that physically contacts the protein. a mutation that disrupts the function of this ncrna is identified. surprisingly, the underlined sequence is normal in the mutant, but the boxed sequence in the dna, taa is changed to act. what is the most likely reason the ncrna no longer functions? from EN Bilgi.

    RNA in unexpected places: long non

    The increased application of transcriptome-wide profiling approaches has led to an explosion in the number of documented long non-coding RNAs (lncRNAs). While these new and enigmatic players in the complex transcriptional milieu are encoded by a significant ...

    Nat Rev Mol Cell Biol. Author manuscript; available in PMC 2016 May 2.

    Published in final edited form as:

    Nat Rev Mol Cell Biol. 2013 Nov; 14(11): 699–712.

    Published online 2013 Oct 9. doi: 10.1038/nrm3679

    PMCID: PMC4852478

    NIHMSID: NIHMS780405

    PMID: 24105322

    RNA in unexpected places: long non-coding RNA functions in diverse cellular contexts

    Sarah Geisler1,2 and Jeff Coller1

    Author information Copyright and License information Disclaimer

    The publisher's final edited version of this article is available at Nat Rev Mol Cell Biol

    See other articles in PMC that cite the published article.

    Go to:

    Abstract

    The increased application of transcriptome-wide profiling approaches has led to an explosion in the number of documented long non-coding RNAs (lncRNAs). While these new and enigmatic players in the complex transcriptional milieu are encoded by a significant proportion of the genome, their functions are mostly unknown. Early discoveries support a paradigm in which lncRNAs regulate transcription via chromatin modulation, but new functions are steadily emerging. Given the biochemical versatility of RNA, lncRNAs may be used for various tasks, including post-transcriptional regulation, organization of protein complexes, cell-cell signalling and allosteric regulation of proteins.

    Dedicated consortiums, such as the ENCODE (Encyclopedia of DNA Elements) project, have markedly expanded our knowledge of what lies in the dark recesses of the genome through their extensive annotation efforts1. These findings in conjunction with previous studies looking specifically at transcriptional outputs have underscored the pervasiveness with which genomes are transcribed2,3. An important implication of these findings is that whereas only a minuscule fraction of the human genome encodes proteins, nearly 60% is represented in processed transcripts that seem to lack protein-coding capacity4. Together with observations that more sophisticated organisms tend to have more non-coding DNA, this raises the possibility that the barren regions between genes are actually elysian fields’ rich with information5. The implications of this are undeniably intriguing, but we are still far from ascribing biological functions to the vast array of non-coding RNA (ncRNA) transcripts. With thousands of documented ncRNAs, pervasive transcription has been described in virtually all eukaryotic organisms6,7.

    For the better part of the past decade, particular attention has focused on the exploding class of transcripts referred to as long non-coding RNAs (lncRNAs), arbitrarily defined as being longer than 200 nucleotides7,8. Given the prevalence of lncRNA expression, it has been posited that lncRNAs might constitute a significant fraction of the functional output of mammalian genomes7–9. Such notions have been met with considerable, and quite possibly legitimate, scepticism10. Indeed, the documentation of pervasive transcription has far outpaced the molecular characterization of the transcripts produced. Although some lncRNA transcripts may represent transcriptional noise, a small but steadily growing list has authentic biological roles6,11–13. For example, lncRNAs have been implicated in regulating imprinting, dosage compensation, cell cycle regulation, pluripotency, retro-transposon silencing, meiotic entry and telomere length, to name just a few12,13. Despite these advances, most lncRNAs remain partially uncharacterized. Additionally, there has been a heavy focus so far on the ways that lncRNAs regulate chromatin states, and this emphasis probably underrepresents the full repertoire of lncRNA function. Nonetheless, the rapidly growing lncRNA field is already changing not just our perspective of genomic content, but also the way we think about genes.

    In this Review, we focus on the functional attributes of RNA and highlight the unconventional, and perhaps underappreciated, biological contributions of lncRNAs, including the diverse mechanisms through which lncRNAs participate in transcriptional regulation. We touch briefly on the roles of lncRNAs in regulating chromatin states, as this has been explored in several recent reviews (see REFS 8,9,13–15). In addition, we highlight roles beyond transcription whereby lncRNAs function in various cellular contexts, including post-transcriptional regulation, post-translational regulation of protein activity, organization of protein complexes, cell-cell signalling, as well as recombination.

    Go to:

    A biochemically versatile polymer

    RNA is a versatile molecule making it well suited for a myriad of functions. It is this feature that inspired the ‘RNA world hypothesis’ in which it was postulated that billions of years ago, RNA provided the precursors of all life16. The multifunctionality of RNA stems from several unique physiochemical properties. First, and perhaps most obvious, is its ability to base pair with other nucleic acids (FIG. 1a). RNA is, therefore, particularly adept at recognizing both RNA and DNA targets through simple one-to-one base pairing interactions. By comparison, proteins such as transcription activator-like effectors (TALEs) and PUF proteins require 100 times more genomic sequence space than an RNA to achieve sequence-specific binding17. Moreover, because two RNA transcripts can base pair at any point during the life cycle of the target mRNA, regulatory RNAs can influence transcription, processing, editing, translation or degradation of target mRNAs. Second, RNA molecules can fold into intricate three-dimensional structures that provide complex recognition surfaces (FIG. 1b). This structure expands the large variety of molecular targets that RNA can bind with high affinity and specificity. RNA structures can even be selected for in vitro to bind to anything from small molecules to proteins18. Third, in terms of both expression and structure, RNA is dynamic. More explicitly, because RNA can be rapidly transcribed and degraded, it is well suited for dynamic, transient expression (FIG. 1c). Moreover, without the need to be translated, a regulatory RNA gene could transition faster from being transcriptionally inactive to fully functional. In addition, as conformational changes can be triggered by ligand binding, RNA structures themselves can be very dynamic19. Fourth, RNA is malleable and therefore provides an excellent platform for evolutionary innovation (FIG. 1d). Specifically, unencumbered by amino acid-coding potential, regulatory RNAs are less restricted in terms of their conservation. As such, RNAs are more tolerant of mutations, which could allow for the rapid evolution of diverse cellular activities. Last, RNA-dependent events can have the capacity to be heritable. This idea is supported by the demonstration of RNA-templated modifications to the genome (FIG. 1e). For example, retroviral genomic integrations as well as the presence of thousands of processed pseudogenes suggest that information housed within mature RNA transcripts can be integrated back into the genome20,21. These instances of RNA-mediated events that have manifested in genomic change suggest it is possible for other RNA-dependent events to become heritable. Importantly, these defining properties of RNAs raise exciting possibilities as to what roles lncRNAs could have in the cell. Although various functional roles have now been attributed to lncRNAs, it is likely that as we dig deeper into the molecular biology of lncRNAs more functions will emerge.

    Source : www.ncbi.nlm.nih.gov

    Frontiers

    The genomes of large multicellular eukaryotes are mostly comprised of non-protein coding DNA. Although there has been much agreement that a small fraction of these genomes has important biological functions, there has been much debate as to whether the rest contributes to development and/or homeostasis. Much of the speculation has centered on the genomic regions that are transcribed into RNA at some low level. Unfortunately these RNAs have been arbitrarily assigned various names, such as “intergenic RNA”, “long non-coding RNAs” etc., which have led to some confusion in the field. Many researchers believe that these transcripts represent a vast, unchartered world of functional non-coding RNAs (ncRNAs), simply because they exist. However, there are reasons to question this Panglossian view because it ignores our current understanding of how evolution shapes eukaryotic genomes and how the gene expression machinery works in eukaryotic cells. Although there are undoubtedly many more functional ncRNAs yet to be discovered and characterized, it is also likely that many of these transcripts are simply junk. Here we discuss how to determine whether any given ncRNA has a function. Importantly, we advocate that in the absence of any such data, the appropriate null hypothesis is that the RNA in question is junk.

    HYPOTHESIS AND THEORY article

    Front. Genet., 26 January 2015 | https://doi.org/10.3389/fgene.2015.00002

    Non-coding RNA: what is functional and what is junk?

    Alexander F. Palazzo* and Eliza S. Lee

    Department of Biochemistry, University of Toronto, Toronto, ON, Canada

    The genomes of large multicellular eukaryotes are mostly comprised of non-protein coding DNA. Although there has been much agreement that a small fraction of these genomes has important biological functions, there has been much debate as to whether the rest contributes to development and/or homeostasis. Much of the speculation has centered on the genomic regions that are transcribed into RNA at some low level. Unfortunately these RNAs have been arbitrarily assigned various names, such as “intergenic RNA,” “long non-coding RNAs” etc., which have led to some confusion in the field. Many researchers believe that these transcripts represent a vast, unchartered world of functional non-coding RNAs (ncRNAs), simply because they exist. However, there are reasons to question this Panglossian view because it ignores our current understanding of how evolution shapes eukaryotic genomes and how the gene expression machinery works in eukaryotic cells. Although there are undoubtedly many more functional ncRNAs yet to be discovered and characterized, it is also likely that many of these transcripts are simply junk. Here, we discuss how to determine whether any given ncRNA has a function. Importantly, we advocate that in the absence of any such data, the appropriate null hypothesis is that the RNA in question is junk.

    Introduction

    Starting with the discovery of transfer RNA and ribosomal RNA in the 1950s, non-coding RNAs (ncRNAs) with biological roles have been known for close to 60 years. Even in the late 1970s and early 1980s the existence of other functional ncRNAs was known, including RNAse P (Stark et al., 1978), snRNAs (Yang et al., 1981), and 7SL [the RNA component of the signal recognition particle (Walter and Blobel, 1982)]. Later, ncRNAs that serve to regulate chromosome structure, such as Xist, were discovered (Brockdorff et al., 1992). Since then, the number of new and putative functional ncRNAs has greatly expanded (for reviews see Wilusz et al., 2009; Wang and Chang, 2011; Ulitsky and Bartel, 2013; Rinn and Guttman, 2014). Interest in this field was further stimulated by the finding that almost all of the mammalian genome is transcribed at some level (Carninci et al., 2005; Birney et al., 2007; Djebali et al., 2012), with some individuals speculating that much of this pervasive transcription is likely functional (Mattick et al., 2010; Ecker et al., 2012; Pennisi, 2012). This idea was epitomized by the ENCODE consortium, which claimed to have assigned “biochemical functions for 80% of the genome” (ENCODE Project Consortium et al., 2012). Others have disagreed, pointing out that the vast majority of these novel transcripts are present at low levels, and that the term “function” had been misappropriated (Eddy, 2012; Doolittle, 2013; Graur et al., 2013; Niu and Jiang, 2013; Palazzo and Gregory, 2014). Despite these criticisms, the idea that the pervasive transcription of the human genome plays some role in homeostasis and/or development persists, with one group even proclaiming that they had “refuted the specific claims that most of the observed transcription across the human genome is random” (Mattick and Dinger, 2013).

    At present, the distinction between functional ncRNAs and junk RNA appears to be quite vague. There has been, however, some effort to differentiate between these two groups, based on various criteria ranging from their expression levels and splicing to conservation. Ultimately these efforts have failed to bring consensus to the field.

    A similar problem has plagued the investigation of whether transposable elements (TEs), which make up a significant proportion of most vertebrate genomes, have been exapted for the benefit of the host organism. Although some have claimed that many TEs are functional, a few groups have offered a much more balanced view that is in line with our current understanding of molecular evolution (de Souza et al., 2013; Elliott et al., 2014).

    In this article we explain several concepts that researchers must keep in mind when evaluating whether a given ncRNA has a function at the organismal level. Importantly, the presence of low abundant non-functional transcripts is entirely consistent with our current understanding of how eukaryotic gene expression works and how the eukaryotic genome is shaped by evolution. With this in mind, researchers should take the approach that an uncharacterized non-coding RNA likely has no function, unless proven otherwise. This is the null hypothesis. If a given ncRNA has supplementary attributes that would not be expected to be found in junk RNA, then this would provide some evidence that this transcript may be functional.

    The Amount of Various RNA Species in the Typical Eukaryotic Cell

    As is evident from a number of sources, almost all of the human genome is transcribed. However, one must not confuse the number of different of transcripts with their in a typical cell. Many of the putative functional ncRNAs are present at very low levels and thus unlikely to be of any importance with respect to cell or organismal physiology. Importantly, the abundance of an ncRNA species roughly correlates with its level of conservation (Managadze et al., 2011), which is a good proxy for function (Doolittle et al., 2014; Elliott et al., 2014; however, see below); thus, determining the relative abundance of a given ncRNA in the relevant cell type is an important piece of information. However, one should keep in mind that if the ncRNA has catalytic activity or if it acts as a scaffold to regulate chromosomal architecture near its site of transcription, the RNA may not need to be present at very high levels to be able to perform its task.

    Source : www.frontiersin.org

    Chapter 13 Flashcards

    Start studying Chapter 13. Learn vocabulary, terms, and more with flashcards, games, and other study tools.

    Chapter 13

    Where in a cell would you NOT expect to find an ncRNA?

    Click card to see definition 👆

    embedded in the plasma membrane

    Click again to see term 👆

    Where in a cell WOULD you expect to find an ncRNA?

    Click card to see definition 👆

    On the outer surface of the endoplasmic reticulum.

    Associated with a large complex of proteins in the cytoplasm.

    Attached to DNA in the nucleus

    Click again to see term 👆

    1/40 Created by CandyCar14

    Terms in this set (40)

    Where in a cell would you NOT expect to find an ncRNA?

    embedded in the plasma membrane

    Where in a cell WOULD you expect to find an ncRNA?

    On the outer surface of the endoplasmic reticulum.

    Associated with a large complex of proteins in the cytoplasm.

    Attached to DNA in the nucleus

    A hypothetical ncRNA is shown below. This ncRNA is known to exert its function by binding to a protein and altering its structure. The underlined segment is the only part of the ncRNA that physically contacts the protein. A mutation that disrupts the function of this ncRNA is identified. Surprisingly, the underlined sequence is normal in the mutant, but the boxed sequence in the DNA, TAA is changed to ACT. What is the most likely reason the ncRNA no longer functions?

    5′ GUAACUUAGCGCUUACUACCCG [UAA] GUACU 3′

    The shape of the mutant ncRNA is different and no longer binds to the protein.

    The function of an ncRNA depends largely on its ability to _____.

    bind to other molecules

    Some ncRNA molecules bind to proteins or small molecules due to _____.

    stem-loop structures

    Other ncRNA molecules may bind to RNA or DNA due to _____.

    complementary base-pairing

    To function as a _____, the structure of an ncRNA molecule must form binding sites for several molecules.

    scaffold scaffold

    binds to several molecules to attach them together

    guide

    directs one molecules to a particular place in the cell

    alternation of protein function

    binds to a protein and changes its structure

    Sign up and see the remaining cards. It’s free!

    Boost your grades with unlimited access to millions of flashcards, games and more.

    Continue with Google

    Continue with Facebook

    Already have an account?

    Recommended textbook explanations

    Biocalculus: Calculus for the Life Sciences

    1st Edition Day, Stewart 5,056 explanations

    Fundamentals of Biochemistry: Life at the Molecular Level

    5th Edition

    Charlotte W. Pratt, Donald Voet, Judith G. Voet

    980 explanations

    Miller and Levine Biology

    1st Edition

    Joseph S. Levine, Kenneth R. Miller

    1,773 explanations

    Biocalculus: Calculus, Probability, and Statistics for the Life Sciences

    1st Edition Day, Stewart 5,059 explanations

    Sets with similar terms

    Bio Exam 17&18

    88 terms hannah_vanzant

    UNIT 5: Chpt. 14

    62 terms sarahc3_umbc

    Chapter 9

    60 terms pineapplelovesguava

    bio 302 exam #3

    90 terms nicole_miles5

    Sets found in the same folder

    Chapter 11 Quiz

    20 terms Funkster98PLUS

    UIUC MCB 150 - Unit 4: Genetics

    1,029 terms Aniket_Joglekar

    Chapter 2: Chemistry I

    88 terms CandyCar14

    UIUC MCB 150 - Unit 5: The Cell Cycle & Epige…

    350 terms Aniket_Joglekar

    Other sets by this creator

    Trigonometry and Trig Derivatives

    14 terms CandyCar14

    Chem 2 Review for Final

    8 terms CandyCar14

    Genki Chapter 1

    108 terms CandyCar14

    Elements Naturally Found in Atomic Pairs

    7 terms CandyCar14

    Verified questions

    BIOLOGY

    What genetic factors might be responsible for a change in an organism's body plan?

    Verified answer BIOLOGY

    How is facilitated diffusion different from diffusion?

    Verified answer BIOLOGY

    How is glucose (a product of starch digestion) transported from the small intestine to the liver?

    Verified answer BIOLOGY

    What sort of evidence can you use to show that all living things grow and develop?

    Verified answer

    Other Quizlet sets

    Ch. 11 General and local anesthetics, exam 4

    33 terms tiffanyschaffer96

    Kinesiology 199 Quiz #5

    11 terms Jordanslavik

    Introduction to Humanities Exam 2 Study Guide

    205 terms Destiny_Navarro74

    Pharm Exam 2- helperchild

    83 terms CHINAREDDPLUS

    Related questions

    QUESTION

    What are the 4 properties of DNA?

    15 answers QUESTION

    Where does the energy for a phosphodiester bond come from?

    11 answers QUESTION

    How many RNA pols do eukaryotes have?

    15 answers QUESTION

    What is the 5' cap made out of?

    15 answers 1/7

    Source : quizlet.com

    Do you want to see answer or more ?
    James 7 month ago
    4

    Guys, does anyone know the answer?

    Click For Answer